smartseq2 v4 kit  (TaKaRa)

Journal: Developmental cell

Article Title: Reprogramming axial level identity to rescue neural crest-related congenital heart defects

doi: 10.1016/j.devcel.2020.04.005

Figure Lengend Snippet: Highlights:

Article Snippet: SmartSeq2 V4 kit , Takara Clontech , Cat#634889.

Techniques: Isolation, Hybridization, Software

Journal: iScience

Article Title: Transcriptional profile of Mycobacterium tuberculosis infection in people living with HIV

doi: 10.1016/j.isci.2024.111228

Figure Lengend Snippet:

Article Snippet: 1 × 100 bp single-end read sequencing kit SmartSeq2 library preparation (20ng total RNA input, minimum read depth 30 million reads per sample) , Illumina , .

Techniques: Recombinant, Sequencing, Software

Journal: Developmental cell

Article Title: Reprogramming axial level identity to rescue neural crest-related congenital heart defects

doi: 10.1016/j.devcel.2020.04.005

Figure Lengend Snippet: Highlights:

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse IgG1 anti-Pax7 Developmental Studies Hybridoma Bank at University of Iowa RRID: AB_528428 Rabbit anti-Sox2 Abcam Cat#ab97959; RRID: AB_2341193 Mouse IgG2b anti-MF20 Developmental Studies Hybridoma Bank at University of Iowa RRID: AB_2147781 Mouse IgM anti-HNK1 Developmental Studies Hybridoma Bank at University of Iowa RRID: AB_2314644 Mouse IgG2a anti-SMA Sigma Cat#3879S; RRID: AB_2255011 Mouse IgG2b anti-HuC/D Invitrogen Cat# A21271; RRID: AB_221448 Goat IgG anti-GFP Rockland Cat# 600-101-215; RRID: AB_218182 Mouse IgG2a anti-V5 Invitrogen Cat#R960–25; RRID: AB_2556564 Rabbit anti-RFP MBL Cat#PM005; RRID: AB_591279 Critical Commercial Assays RNAqueous Micro Total RNA isolation kit Ambion Cat#AM1931 SmartSeq2 V4 kit Takara Clontech Cat#634889 Nextera XT DNA library preparation kit Illumina Cat#FC-131–1024 Qubit High sensitivity DNA kit ThermoFisher Scientific Cat# {"type":"entrez-protein","attrs":{"text":"Q32854","term_id":"75280861","term_text":"Q32854"}} Q32854 NEB Next High-Fidelity 2X PCR Master Mix New England Biolabs Cat#M0543S NextSeq 500/550 High Output Kit v2 (75 cycles) Illumina Cat#FC-404–2005 Endofree maxi prep kit Macharey Nagel Cat#740426.50 Agencourt AMPure XP beads Beckman Coulter Cat#A63880 illustra MicroSpin G-50 Columns GE Healthcare Life Sciences Cat# 27533001 Hybridization Chain Reaction Molecular Technologies NA Deposited Data Raw and analyzed data This paper BioProject ID PRJNA515142 Software and Algorithms Fiji/ImageJ ( Schindelin et al., 2012 ) https://imagej.nih.gov/ij/ Bowtie2 ( Langmead and Salzberg, 2012 ) http://bowtie-bio.sourceforge.net/bowtie2/index.shtml Samtools http://samtools.sourceforge.net/ HTSeq-count https://htseq.readthedocs.io/en/release_0.11.1/count.html Seurat ( Butler et al., 2018 ) https://satijalab.org/seurat/ Oligonucleotides GCAGGTGTAGTTGCAATATC This paper Tgif1.1.gRNA GTTGGTCCCCCGCCGTGAGA This paper Tgif1.2.gRNA GGGTCATGTTGAGCATTTGG This paper Sox8.1.gRNA gTCCACCTTAGCGCCCAGCG This paper Sox8.2.gRNA GACGCGACGCCCATCCTCAA This paper Sox8.3.gRNA GGCCTCAACCATGAAGGCGG This paper Ets1.1.gRNA GACCTTCAGTGGCTTCGCAA This paper Ets1.2.gRNA GAGAGACGCACGTGCGGGAC This paper Ets1.3.gRNA GAAAGTCAGGCGCTAGCTCC This paper Ets1.4.gRNA Open in a separate window Highlights: Ablations reveal laterality differences in neural crest contributions to the heart Transcriptional profiling reveals Tgif1 as critical for outflow tract morphogenesis Sox8, Tgif1 , and Ets1 comprise a regulatory subcircuit for cardiac crest specification Expression of subcircuit genes in trunk reprograms them toward cardiac crest-like fate

Techniques: Isolation, Hybridization, Software